rs10206957 chr2:127701640 C>G
- Sequence
gagaaggcggaggagcccggggac[C/G]ggccggcggaggagtggctgggcc
- ASB in cell types
- GM12878 (female B-cells lymphoblastoid cell line) GM18486 (Lymphoblastoid Cell Lines)
- ASB for transcription factors
- ZN687_HUMAN ZFX_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| ZN687_HUMAN | -2.16 | 2.54 | 1.50 | n/a | n/a | |||
| ZFX_HUMAN | 0.29 | 1.09 | 1.00 | n/a | No Hit |
Items per page:
1 – 2 of 2
Motif analysis
No data available
Genetic associations
GTEx eQTL Adipose_Subcutaneous, Adipose_Visceral_Omentum, Artery_Aorta, Artery_Tibial, Esophagus_Gastroesophageal_Junction, Esophagus_Mucosa, Esophagus_Muscularis, Heart_Atrial_Appendage, Heart_Left_Ventricle, Lung, Muscle_Skeletal, Nerve_Tibial, Skin_Not_Sun_Exposed_Suprapubic, Skin_Sun_Exposed_Lower_leg, Stomach, Testis, Thyroid