rs10210408 chr2:169190340 C>T
- Sequence
tttgcattgtcagttcacaaacta[C/T]cacctctcagcaatgtccactcat
- ASB in cell types
- K562 (myelogenous leukemia)
- ASB for transcription factors
- REST_HUMAN ZN316_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| REST_HUMAN | 2.74 | -2.62 | 1.00 | n/a | No Hit | |||
| ZN316_HUMAN | 2.14 | -1.80 | 1.00 | n/a | No Hit |
Items per page:
1 – 2 of 2
Motif analysis
No data available
Genetic associations
GRASP hdl cholesterol change with statins, irritible bowel syndrome, ldl cholesterol change with statins, schizophrenia, spine bone mineral density (bmd), total cholesterol change with statins, urinary albumin-to-creatinine ratio