rs10215475 chr7:121159738 T>C
- Sequence
cactctgttgttgtatattactct[T/C]gtctctctccctcactcgcacaca
- ASB in cell types
- K562 (myelogenous leukemia)
- ASB for transcription factors
- ILF3_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (T) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| ILF3_HUMAN | 2.36 | -1.66 | 1.75 | n/a | n/a |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GRASP advanced age-related macular degeneration, advanced age-related macular degeneration (choroidal neovascularization) vs. no amd, ldl cholesterol change with statins, major depressive disorder, total body bone mineral density (bmd), total cholesterol, total cholesterol change with statins
GTEx eQTL Adipose_Subcutaneous, Brain_Putamen_basal_ganglia, Cells_Cultured_fibroblasts, Esophagus_Muscularis