rs10216375 chr8:126824520 T>C
- Sequence
gagtgaagtggaatgggtcaactt[T/C]aacgttcagtgaggacgaattcta
- ASB in cell types
- GM12878 (female B-cells lymphoblastoid cell line) GM18526 (B – cells Lymphoblastoid Cell Lines)
- ASB for transcription factors
- ZNF24_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (T) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| ZNF24_HUMAN | 2.56 | n/a | 1.00 | n/a | No Hit |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GRASP aortic valve calcium, infant head circumference, ldl cholesterol, lp-pla2 mass, maternal transmission distortion, refractive error, total cholesterol, transmission distortion