rs10216767 chr8:107496243 A>G
- Sequence
ttgagacattgcctcccttctagt[A/G]gcatagtcagttgaatatacttat
- ASB in cell types
- GM02630 (Fanconi anemi)
View in PheLiGe Color scale
-log10 FDR of Ref (A) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| GM02630 (Fanconi anemi) | 1.94 | -1.10 | 1.00 |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GRASP advanced age-related macular degeneration (choroidal neovascularization) vs. no amd, ldl cholesterol change with statins, total cholesterol change with statins