rs10218714 chr1:176073953 G>C
- Sequence
tcaaatacttgtttaggcctcttt[G/C]tttgagacagagtctcattctgtt
- ASB in cell types
- GM18526 (B – cells Lymphoblastoid Cell Lines) SK-N-SH (neuroblastoma)
- ASB for transcription factors
- STAG1_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| STAG1_HUMAN | 2.11 | -0.03 | 1.00 | n/a | n/a |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GTEx eQTL Brain_Cerebellar_Hemisphere, Brain_Cerebellum, Cells_Cultured_fibroblasts, Nerve_Tibial, Spleen, Thyroid, Whole_Blood