rs10219339 chr11:75773805 A>G
- Sequence
gagtgatctgagcaatgacaggaa[A/G]gactgccaagaggtgagaccgggg
- ASB in cell types
- CD14+ monocytes
- ASB for transcription factors
- STAT1_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (A) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| STAT1_HUMAN | 2.61 | n/a | 3.00 | -0.68 | Weak Concordant |
Items per page:
1 – 1 of 1
Motif analysis
Genetic associations
GRASP age at death with kuru exposure, hdl cholesterol, mitral annular calcium, partial epilepsy, serum creatinine, sporadic creutzfeldt-jakob disease, total cholesterol, triglycerides
GTEx eQTL Adipose_Visceral_Omentum, Artery_Aorta, Lung, Skin_Not_Sun_Exposed_Suprapubic, Skin_Sun_Exposed_Lower_leg, Testis, Whole_Blood