rs10220442 chr14:45610680 A>G
- Sequence
ctgcttttcaatgaatgcattcac[A/G]tggacaataaaatctgatgcagta
- ASB in cell types
- bipolar neuron foreskin keratinocyte
View in PheLiGe Color scale
-log10 FDR of Ref (A) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| bipolar neuron | 2.74 | n/a | 1.00 | |||
| foreskin keratinocyte | -0.24 | 1.66 | 2.00 |
Items per page:
1 – 2 of 2