rs10221271 chr17:70630229 C>T
- Sequence
ttaatttaaaaacacacacacaca[C/T]ggagagaaagagagagaagagttt
- ASB in cell types
- GM12891 (male B- cells lymphoblastoid cell line) GM12878 (female B-cells lymphoblastoid cell line) GM18526 (B – cells Lymphoblastoid Cell Lines) 22RV1 (prostate carcinoma)
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| GM12891 (male B- cells lymphoblastoid cell line) | -1.16 | 1.43 | 1.00 | |||
| GM12878 (female B-cells lymphoblastoid cell line) | -1.15 | 1.46 | 1.00 | |||
| GM18526 (B – cells Lymphoblastoid Cell Lines) | 1.84 | -0.43 | 1.00 | |||
| 22RV1 (prostate carcinoma) | 1.46 | -0.49 | 1.50 | |||
| GM19193 (female B-cells Lymphoblastoid Cell Lines) | -0.02 | 1.80 | 1.00 |
Items per page:
1 – 5 of 5