rs10221893 chr2:136256036 C>T
- Sequence
aacagggaaccagtctccattaca[C/T]gatgggcaaatcactcaagtagca
- ASB in cell types
- GM12890 (Lymphoblastoid Cell Lines) GM12878 (female B-cells lymphoblastoid cell line)
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| GM12890 (Lymphoblastoid Cell Lines) | -2.84 | 2.74 | 1.00 | |||
| GM12878 (female B-cells lymphoblastoid cell line) | n/a | 2.25 | 2.00 |
Items per page:
1 – 2 of 2
Motif analysis
No data available
Genetic associations
GRASP body mass index (bmi), comorbid depressive syndrome and alcohol dependence, cystatin c in serum, fasting insulin, hdl cholesterol, homa-b, homa-ir, ldl cholesterol, leukocyte telomere length, parkinsons disease, parkinsons disease (pd), sporadic creutzfeldt-jakob disease, total cholesterol, waist hip ratio
GTEx eQTL Adipose_Subcutaneous, Artery_Tibial, Brain_Cerebellar_Hemisphere, Esophagus_Mucosa, Esophagus_Muscularis, Heart_Left_Ventricle, Lung, Skin_Sun_Exposed_Lower_leg, Thyroid, Whole_Blood