rs10221977 chr2:112939699 A>G
- Sequence
gtgagcagctgtggctctgggccc[A/G]gacccacagggcgataaggcacag
- ASB in cell types
- 22RV1 (prostate carcinoma) MDA-MB-453 (breast adenocarcinoma)
View in PheLiGe Color scale
-log10 FDR of Ref (A) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| 22RV1 (prostate carcinoma) | 3.02 | -5.34 | 2.00 | |||
| MDA-MB-453 (breast adenocarcinoma) | 1.95 | -3.35 | 1.50 |
Items per page:
1 – 2 of 2
Motif analysis
No data available
Genetic associations
GTEx eQTL Artery_Tibial, Esophagus_Mucosa, Skin_Not_Sun_Exposed_Suprapubic, Skin_Sun_Exposed_Lower_leg