rs10224956 chr7:33156742 A>G
- Sequence
tggctttctttattactcttcacc[A/G]tgttctgttttcgtccccttctct
- ASB in cell types
- SU-DHL-1 (Anaplastic large cell lymphoma) JB6 (Human anaplastic large cell lymphoma)
- ASB for transcription factors
- CEBPB_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (A) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| CEBPB_HUMAN | -0.38 | 2.30 | 1.17 | n/a | No Hit |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GRASP amyotrophic lateral sclerosis (als) (early age of onset), hdl cholesterol change with statins, infant head circumference, irritible bowel syndrome, obesity with early age of onset (age >2), refractive error, simpson-angus scale, triglycerides
GTEx eQTL Adipose_Subcutaneous, Brain_Amygdala, Brain_Anterior_cingulate_cortex_BA24, Brain_Cortex, Brain_Frontal_Cortex_BA9, Brain_Putamen_basal_ganglia, Brain_Spinal_cord_cervical_c-1, Nerve_Tibial, Skin_Sun_Exposed_Lower_leg, Thyroid