rs10225529 chr7:99365532 T>C
- Sequence
agaagctgaggcaggaggatcact[T/C]gagcccaggagttggaggctgcag
- ASB in cell types
- bipolar neuron SK-N-SH (neuroblastoma)
View in PheLiGe Color scale
-log10 FDR of Ref (T) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| bipolar neuron | -1.55 | 1.94 | 1.00 | |||
| SK-N-SH (neuroblastoma) | n/a | 1.52 | 2.00 |
Items per page:
1 – 2 of 2
Motif analysis
No data available
Genetic associations
GTEx eQTL Adipose_Subcutaneous, Adipose_Visceral_Omentum, Artery_Tibial, Brain_Cortex, Brain_Frontal_Cortex_BA9, Brain_Putamen_basal_ganglia, Cells_Cultured_fibroblasts, Colon_Sigmoid, Esophagus_Mucosa, Esophagus_Muscularis, Lung, Nerve_Tibial, Pancreas, Skin_Not_Sun_Exposed_Suprapubic, Skin_Sun_Exposed_Lower_leg, Testis, Thyroid, Whole_Blood