rs10226377 chr7:133051171 C>A
- Sequence
cataacaacaattacacctgctag[C/A]tttaaacttctccaaacactgaca
- ASB in cell types
- GM12890 (Lymphoblastoid Cell Lines) GM18526 (B – cells Lymphoblastoid Cell Lines)
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| GM12890 (Lymphoblastoid Cell Lines) | 1.40 | -2.46 | 1.33 | |||
| GM18526 (B – cells Lymphoblastoid Cell Lines) | -1.66 | 1.89 | 1.00 |
Items per page:
1 – 2 of 2