rs10227726 chr7:39953474 C>G
- Sequence
tgtacttatcaggttttttagttg[C/G]tggatacttcagcgagatccttta
- ASB for transcription factors
- ZN316_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| ZN316_HUMAN | n/a | 2.86 | 2.00 | n/a | No Hit |
Items per page:
1 – 1 of 1