rs10229029 chr7:44885890 C>T
- Sequence
ctgggaacagagttccagtctata[C/T]actggcgaccggggggagggagat
- ASB in cell types
- HEK293 (embryonic kidney) GM12878 (female B-cells lymphoblastoid cell line) CHL-1 (Melanoma) monocyte-derived macrophages from peripheral blood
- ASB for transcription factors
- FOXK2_HUMAN ZN341_HUMAN SPI1_HUMAN BRD4_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| FOXK2_HUMAN | -3.13 | 3.17 | 1.00 | n/a | No Hit | |||
| ZN341_HUMAN | -2.93 | 1.99 | 1.50 | n/a | No Hit | |||
| SPI1_HUMAN | 0.97 | 3.06 | 1.70 | n/a | No Hit | |||
| BRD4_HUMAN | 0.17 | 1.53 | 1.20 | n/a | n/a | |||
| BRD2_HUMAN | 0.93 | 2.52 | 2.00 | n/a | n/a |
Items per page:
1 – 5 of 7
Motif analysis
No data available
Genetic associations
GRASP comorbid depressive syndrome and alcohol dependence, hdl cholesterol, mitral annular calcium, rheumatoid arthritis
GTEx eQTL Adipose_Subcutaneous, Adipose_Visceral_Omentum, Adrenal_Gland, Artery_Aorta, Artery_Tibial, Breast_Mammary_Tissue, Cells_Cultured_fibroblasts, Esophagus_Gastroesophageal_Junction, Esophagus_Mucosa, Esophagus_Muscularis, Lung, Muscle_Skeletal, Nerve_Tibial, Skin_Not_Sun_Exposed_Suprapubic, Skin_Sun_Exposed_Lower_leg, Testis, Thyroid, Whole_Blood