rs10229733 chr7:77439781 G>A
- Sequence
tctcaccagcggaagtgttatgac[G/A]tgccacttctggacggaggtggca
- ASB in cell types
- THP-1 (acute monocytic leukemia) neutrophils from periferal blood GM18486 (Lymphoblastoid Cell Lines) PC9 (lung adenocarcinoma)
- ASB for transcription factors
- CREB1_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| CREB1_HUMAN | 2.21 | -0.53 | 1.50 | -4.40 | Concordant |
Items per page:
1 – 1 of 1
Motif analysis
Genetic associations
GTEx eQTL Adipose_Subcutaneous, Artery_Tibial, Brain_Caudate_basal_ganglia, Brain_Cerebellum, Colon_Transverse, Muscle_Skeletal