rs10230435 chr7:130441110 C>T
- Sequence
cttccccggccggccaatgggggc[C/T]ccgtttactctctcatctcagggt
- ASB in cell types
- GM12878 (female B-cells lymphoblastoid cell line) CD14+ monocytes
- ASB for transcription factors
- COT1_HUMAN NR2C1_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| COT1_HUMAN | 3.20 | -2.88 | 1.00 | n/a | No Hit | |||
| NR2C1_HUMAN | 1.09 | -1.09 | 1.00 | n/a | No Hit |
Items per page:
1 – 2 of 2
Motif analysis
No data available
Genetic associations
GTEx eQTL Brain_Cerebellar_Hemisphere, Breast_Mammary_Tissue, Cells_Cultured_fibroblasts, Heart_Atrial_Appendage, Lung, Thyroid