rs10230610 chr7:124785344 A>C
- Sequence
tctggcaccagatttttttctgca[A/C]gattagtccagaatactgtgggaa
- ASB in cell types
- HEK293 (embryonic kidney) K562 (myelogenous leukemia) Kelly (neuroblastoma) foreskin keratinocyte
View in PheLiGe Color scale
-log10 FDR of Ref (A) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| HEK293 (embryonic kidney) | -0.06 | 0.68 | 2.00 | |||
| K562 (myelogenous leukemia) | 0.02 | 0.63 | 1.50 | |||
| Kelly (neuroblastoma) | 0.55 | 1.53 | 2.00 | |||
| foreskin keratinocyte | 0.41 | n/a | 2.67 |
Items per page:
1 – 4 of 4