rs10230858 chr7:38177953 G>A
- Sequence
ccgaataactgaagggaagcggaa[G/A]gcgcagaaacgcggacgaagagga
- ASB in cell types
- HEK293 (embryonic kidney) MOLT-4 (Adult T acute lymphoblastic leukemia) macrophages form periferal blood HCC1806(Squamous cell breast carcinoma, acantholytic variant)
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| HEK293 (embryonic kidney) | 0.72 | 0.56 | 1.25 | |||
| MOLT-4 (Adult T acute lymphoblastic leukemia) | 1.31 | 0.38 | 1.67 | |||
| macrophages form periferal blood | -1.01 | 1.74 | 2.00 | |||
| HCC1806(Squamous cell breast carcinoma, acantholytic variant) | 1.33 | -0.24 | 2.00 | |||
| GM12878 (female B-cells lymphoblastoid cell line) | -1.25 | 1.84 | 1.00 |
Items per page:
1 – 5 of 5
Motif analysis
No data available
Genetic associations
GRASP body mass index (bmi), ldl cholesterol, rheumatoid arthritis, serum creatinine, total cholesterol
GTEx eQTL Brain_Caudate_basal_ganglia, Brain_Cortex, Brain_Frontal_Cortex_BA9, Brain_Nucleus_accumbens_basal_ganglia, Brain_Putamen_basal_ganglia, Cells_Cultured_fibroblasts, Lung, Skin_Sun_Exposed_Lower_leg, Stomach, Testis, Thyroid, Whole_Blood