rs10230862 chr7:1785685 T>G
- Sequence
tcttttatgtgtgataggaagtcg[T/G]aggtggtctgtttgttgtagtgta
- ASB in cell types
- HepG2 (hepatoblastoma)
- ASB for transcription factors
- SPI1_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (T) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| SPI1_HUMAN | 1.78 | -0.00 | 1.70 | 0.31 | Weak Discordant |
Items per page:
1 – 1 of 1
Motif analysis
