rs10231350 chr7:92179185 G>T
- Sequence
ccctctgctccgctgcgccctggc[G/T]cggccgcacccactgcgcgtttgt
- ASB in cell types
- HEK293 (embryonic kidney) CD14+ monocytes SK-N-AS (neuroblastoma)
- ASB for transcription factors
- ZN335_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| ZN335_HUMAN | 1.95 | -3.32 | 1.33 | n/a | No Hit |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GTEx eQTL Brain_Cerebellum, Esophagus_Mucosa, Muscle_Skeletal, Nerve_Tibial, Skin_Not_Sun_Exposed_Suprapubic, Testis, Whole_Blood