rs10232196 chr7:12297923 C>G
- Sequence
gtcttgccactaagacctgattta[C/G]cagcataacctgttttgggtcatg
- ASB in cell types
- T47D (invasive ductal carcinoma) iPS-derived dermal fibroblasts MCF10A (breast epithelial cells)
- ASB for transcription factors
- GRHL2_HUMAN RARA_HUMAN HIF1A_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| GRHL2_HUMAN | 3.33 | n/a | 1.50 | -2.01 | Concordant | |||
| RARA_HUMAN | 2.74 | n/a | 1.00 | n/a | No Hit | |||
| HIF1A_HUMAN | 2.86 | n/a | 1.50 | n/a | No Hit |
Items per page:
1 – 3 of 3
Motif analysis
Genetic associations
GRASP ldl cholesterol, ldl cholesterol change with statins, paclitaxel-induced cytotoxicity in lymphoblastoid cell lines, total cholesterol, total cholesterol change with statins
GTEx eQTL Brain_Cortex, Cells_Cultured_fibroblasts, Esophagus_Mucosa, Heart_Atrial_Appendage, Ovary, Skin_Not_Sun_Exposed_Suprapubic, Skin_Sun_Exposed_Lower_leg, Testis, Thyroid