rs10232353 chr7:121159823 G>C
- Sequence
gcttaggtcttttatcatcctcac[G/C]tagcacaatgcctggaaagttctt
- ASB in cell types
- K562 (myelogenous leukemia)
- ASB for transcription factors
- ILF3_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| ILF3_HUMAN | -1.89 | 2.52 | 1.75 | n/a | n/a |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GRASP bone thickness, bone strength, osteoporotic fracture risk, hdl cholesterol, infant head circumference, waist hip ratio