rs10235391 chr7:26348645 G>T
- Sequence
gtgtagctggaatgatcgcctggc[G/T]tcaaatccattgcccttagaacaa
- ASB in cell types
- GM12878 (female B-cells lymphoblastoid cell line)
- ASB for transcription factors
- ZN687_HUMAN HNF4A_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| ZN687_HUMAN | 1.68 | -1.51 | 1.00 | n/a | n/a | |||
| HNF4A_HUMAN | 0.37 | 1.72 | 2.33 | n/a | No Hit |
Items per page:
1 – 2 of 2
Motif analysis
No data available
Genetic associations
GTEx eQTL Cells_Cultured_fibroblasts, Esophagus_Mucosa, Skin_Not_Sun_Exposed_Suprapubic, Skin_Sun_Exposed_Lower_leg