rs10239342 chr7:130369471 T>G
- Sequence
tgatgggactggcaggctgtacta[T/G]gcagcagggatagcagggctgttt
- ASB in cell types
- HepG2 (hepatoblastoma) HUVEC-C (HUVEC, umbilical vein endothelial cells)
View in PheLiGe Color scale
-log10 FDR of Ref (T) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| HepG2 (hepatoblastoma) | 1.01 | 0.00 | 1.18 | |||
| HUVEC-C (HUVEC, umbilical vein endothelial cells) | 1.42 | -4.51 | 2.50 |
Items per page:
1 – 2 of 2
Motif analysis
No data available
Genetic associations
GTEx eQTL Adipose_Subcutaneous, Adipose_Visceral_Omentum, Adrenal_Gland, Artery_Aorta, Brain_Cortex, Breast_Mammary_Tissue, Cells_Cultured_fibroblasts, Esophagus_Gastroesophageal_Junction, Esophagus_Muscularis, Lung, Nerve_Tibial, Prostate, Skin_Sun_Exposed_Lower_leg, Spleen, Thyroid