rs10240053 chr7:25566105 A>C
- Sequence
cgccctcctgtggtaggatttagc[A/C]atcggccacagacaagaaaacaaa
- ASB in cell types
- neutrophils from periferal blood epidermal keratinocytes Kelly (neuroblastoma) THP-1 (acute monocytic leukemia)
- ASB for transcription factors
- STAT1_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (A) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| STAT1_HUMAN | 1.45 | -0.19 | 1.67 | n/a | No Hit |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GRASP hdl cholesterol change with statins, ldl cholesterol change with statins, transmission distortion