rs10243882 chr7:144863575 T>C
- Sequence
gatttgcaaatattttctcctatt[T/C]tgtgggagataacttttttgcaat
- ASB in cell types
- K562 (myelogenous leukemia)
View in PheLiGe Color scale
-log10 FDR of Ref (T) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| K562 (myelogenous leukemia) | 0.74 | -0.18 | 1.47 |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GTEx eQTL Adrenal_Gland, Artery_Aorta, Cells_Cultured_fibroblasts, Cells_EBV-transformed_lymphocytes, Colon_Transverse, Esophagus_Muscularis, Heart_Left_Ventricle, Liver, Muscle_Skeletal, Pancreas, Spleen, Thyroid, Whole_Blood