rs10743185 chr12:121918529 G>A
- Sequence
acgtgaccaccgccctgccctgtc[G/A]ctttagggcctgtcgcttccggcg
- ASB in cell types
- Peyer's patch GBM39 (Human brain tumor) epithelial cell of prostate esophagus squamous epithelium
- ASB for transcription factors
- CTCF_HUMAN JUN_HUMAN SMC3_HUMAN CDN1B_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| CTCF_HUMAN | 2.40 | 0.45 | 1.70 | n/a | No Hit | |||
| JUN_HUMAN | 2.04 | 1.60 | 1.36 | n/a | No Hit | |||
| SMC3_HUMAN | 4.23 | -4.02 | 1.00 | n/a | n/a | |||
| CDN1B_HUMAN | 1.55 | -0.07 | 1.36 | n/a | n/a | |||
| STAG1_HUMAN | 1.49 | -0.15 | 1.85 | n/a | n/a |
Items per page:
1 – 5 of 9
Motif analysis
Genetic associations
GTEx eQTL Adipose_Subcutaneous, Adipose_Visceral_Omentum, Artery_Aorta, Artery_Coronary, Artery_Tibial, Brain_Cerebellar_Hemisphere, Brain_Cerebellum, Brain_Cortex, Brain_Hippocampus, Brain_Substantia_nigra, Breast_Mammary_Tissue, Cells_Cultured_fibroblasts, Colon_Sigmoid, Colon_Transverse, Esophagus_Gastroesophageal_Junction, Esophagus_Mucosa, Esophagus_Muscularis, Heart_Atrial_Appendage, Heart_Left_Ventricle, Lung, Muscle_Skeletal, Nerve_Tibial, Pancreas, Pituitary, Skin_Not_Sun_Exposed_Suprapubic, Skin_Sun_Exposed_Lower_leg, Spleen, Stomach, Testis, Thyroid, Whole_Blood