rs10779788 chr1:5885930 G>A
- Sequence
tttgtgaaaacctctccctctccc[G/A]tcagcgccggagtctcccaggctg
- ASB in cell types
- K562 (myelogenous leukemia)
- ASB for transcription factors
- MEIS2_HUMAN BRD9_HUMAN PKNX1_HUMAN KDM1A_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| MEIS2_HUMAN | 1.48 | -1.48 | 1.00 | n/a | No Hit | |||
| BRD9_HUMAN | 2.98 | n/a | 1.00 | n/a | n/a | |||
| PKNX1_HUMAN | 2.17 | -1.86 | 1.00 | n/a | No Hit | |||
| KDM1A_HUMAN | 0.82 | 0.22 | 1.00 | n/a | n/a | |||
| NR2F6_HUMAN | 2.61 | -4.69 | 1.50 | n/a | No Hit |
Items per page:
1 – 5 of 5
Motif analysis
No data available
Genetic associations
GTEx eQTL Adipose_Subcutaneous, Adipose_Visceral_Omentum, Adrenal_Gland, Artery_Aorta, Artery_Tibial, Brain_Anterior_cingulate_cortex_BA24, Brain_Caudate_basal_ganglia, Brain_Cerebellar_Hemisphere, Brain_Cerebellum, Brain_Cortex, Brain_Hippocampus, Brain_Nucleus_accumbens_basal_ganglia, Brain_Putamen_basal_ganglia, Breast_Mammary_Tissue, Cells_Cultured_fibroblasts, Cells_EBV-transformed_lymphocytes, Colon_Sigmoid, Esophagus_Gastroesophageal_Junction, Esophagus_Mucosa, Esophagus_Muscularis, Heart_Atrial_Appendage, Heart_Left_Ventricle, Liver, Lung, Nerve_Tibial, Ovary, Spleen, Whole_Blood