rs10813990 chr9:33506672 C>T
- Sequence
ctctgtgaaaaaaaagcacaattt[C/T]gtcagatgtggtggcacgtgccta
- ASB in cell types
- MDA-MB-231 (breast adenocarcinoma) HAEC (human aortic endothelial cells) MDA-MB-231-1833 (breast cancer cells, bone-tropic metastatic line)
- ASB for transcription factors
- JUN_HUMAN BRD4_HUMAN FOS_HUMAN TEAD4_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| JUN_HUMAN | 1.99 | 0.32 | 2.00 | n/a | No Hit | |||
| BRD4_HUMAN | 2.12 | -0.14 | 1.64 | n/a | n/a | |||
| FOS_HUMAN | 1.99 | -1.76 | 1.00 | n/a | No Hit | |||
| TEAD4_HUMAN | 1.33 | -1.33 | 1.00 | n/a | No Hit |
Items per page:
1 – 4 of 4
Motif analysis
No data available
Genetic associations
GTEx eQTL Adipose_Subcutaneous, Adipose_Visceral_Omentum, Artery_Aorta, Artery_Tibial, Brain_Cerebellar_Hemisphere, Brain_Cerebellum, Brain_Cortex, Brain_Frontal_Cortex_BA9, Brain_Hippocampus, Brain_Hypothalamus, Brain_Nucleus_accumbens_basal_ganglia, Breast_Mammary_Tissue, Cells_Cultured_fibroblasts, Colon_Sigmoid, Esophagus_Gastroesophageal_Junction, Esophagus_Mucosa, Heart_Left_Ventricle, Muscle_Skeletal, Nerve_Tibial, Pancreas, Skin_Not_Sun_Exposed_Suprapubic, Skin_Sun_Exposed_Lower_leg, Stomach, Testis, Thyroid, Whole_Blood