rs10814208 chr9:3526374 A>G
- Sequence
gtgattccaggcactttgtgaaga[A/G]acgagctatggcgagggaagaatc
- ASB in cell types
- primary B-CLL cells CD4+ T-cells 22RV1 (prostate carcinoma) BEAS-2B (bronchial epithelium)
- ASB for transcription factors
- GCR_HUMAN ANDR_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (A) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| GCR_HUMAN | 0.24 | 1.29 | 1.07 | n/a | No Hit | |||
| ANDR_HUMAN | 2.33 | -4.79 | 2.00 | n/a | No Hit |
Items per page:
1 – 2 of 2