rs10814744 chr9:38713591 G>A
- Sequence
aatcaatggacaaaactggaacac[G/A]gacaattacaggattgcatcagtg
- ASB in cell types
- K562 (myelogenous leukemia) liver THP-1 (acute monocytic leukemia)
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| K562 (myelogenous leukemia) | 2.42 | -1.96 | 1.00 | |||
| liver | 1.05 | -0.18 | 1.00 | |||
| THP-1 (acute monocytic leukemia) | -0.96 | 1.22 | 1.67 |
Items per page:
1 – 3 of 3