rs10814918 chr9:4297421 A>C
- Sequence
aagccagggtccactctagcttta[A/C]tagtctctcctcgagattcccggc
- ASB in cell types
- MS-1 (Small cell lung carcinoma) hepatocytes SYO-1(Biphasic synovial sarcoma)
View in PheLiGe Color scale
-log10 FDR of Ref (A) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| MS-1 (Small cell lung carcinoma) | 0.81 | 0.01 | 1.00 | |||
| hepatocytes | -1.09 | 1.46 | 1.00 | |||
| SYO-1(Biphasic synovial sarcoma) | -1.49 | 1.81 | 1.00 |
Items per page:
1 – 3 of 3