rs10816652 chr9:108270079 T>G
- Sequence
tctgcctaatagtggagcaggagg[T/G]cttgctcagggcaccagaataagc
- ASB in cell types
- GM02255 (Lymphoblastoid Cell Lines) GM02610 (Lymphoblastoid Cell Lines)
- ASB for transcription factors
- CTCF_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (T) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| CTCF_HUMAN | -0.03 | 3.58 | 1.29 | n/a | No Hit |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GRASP homa-b, homa-ir, ldl cholesterol, parkinsons disease, total cholesterol, triglycerides, triglycerides change with statins