rs10816904 chr9:109880476 G>T
- Sequence
ctggtgaggggtggagctaaaaca[G/T]caccactgcagagggagaggacag
- ASB in cell types
- GM12892 (female B-cells lymphoblastoid cell line)
- ASB for transcription factors
- CTCF_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| CTCF_HUMAN | 1.31 | 0.42 | 1.18 | n/a | No Hit |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GRASP 2 hour glucose, advanced age-related macular degeneration (choroidal neovascularization) vs. no amd, ldl cholesterol, ldl cholesterol change with statins, parkinsons disease, serum creatinine, total cholesterol