rs10817193 chr9:111597921 C>G
- Sequence
acctctttcagatggaaacagcca[C/G]gcatttcaaggcagtctcagaact
- ASB in cell types
- Peyer's patch CD34+ stem cells-derived erythroblasts LUHMES (lund human mesencephalic cells)
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| Peyer's patch | 1.46 | -0.97 | 1.00 | |||
| CD34+ stem cells-derived erythroblasts | -0.19 | 2.58 | 2.00 | |||
| LUHMES (lund human mesencephalic cells) | -1.12 | 1.72 | 1.00 |
Items per page:
1 – 3 of 3
Motif analysis
No data available
Genetic associations
GRASP fasting insulin, systolic blood pressure (sbp), triglycerides change with statins, waist hip ratio
GTEx eQTL Adipose_Subcutaneous, Adipose_Visceral_Omentum, Artery_Aorta, Artery_Tibial, Brain_Hypothalamus, Brain_Nucleus_accumbens_basal_ganglia, Breast_Mammary_Tissue, Cells_Cultured_fibroblasts, Colon_Sigmoid, Colon_Transverse, Esophagus_Gastroesophageal_Junction, Esophagus_Muscularis, Heart_Atrial_Appendage, Heart_Left_Ventricle, Lung, Muscle_Skeletal, Nerve_Tibial, Ovary, Pituitary, Skin_Not_Sun_Exposed_Suprapubic, Skin_Sun_Exposed_Lower_leg, Spleen, Testis, Thyroid, Whole_Blood