rs10817542 chr9:113963201 G>A
- Sequence
ggttggtgggtgcttcttgcaagc[G/A]cagtgccccctgcaggcctccagg
- ASB in cell types
- HMF (human mammary fibroblasts) bipolar neuron Peyer's patch gastroesophageal sphincter
- ASB for transcription factors
- CTCF_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| CTCF_HUMAN | 0.93 | 1.02 | 1.29 | 0.62 | Weak Concordant |
Items per page:
1 – 1 of 1
Motif analysis
Genetic associations
GRASP adiponectin levels, birth weight, comorbid depressive syndrome and alcohol dependence, diastolic blood pressure (dbp), homa-b, neuroblastoma (brain cancer), paternal transmission distortion, prop taste detection threshold, transmission distortion