rs10818468 chr9:98074607 C>T
- Sequence
caggaggcggcaaaatgaggcgcc[C/T]cttccctttccagcaggaattggc
- ASB in cell types
- erythroid cells GM12878 (female B-cells lymphoblastoid cell line) glioblastoma cells adult erythroblasts
- ASB for transcription factors
- KDM6A_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| KDM6A_HUMAN | 2.40 | n/a | 4.00 | n/a | n/a |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GRASP adiponectin levels, infant head circumference, mitral annular calcium, obesity with early age of onset (age >2), parkinsons disease, urinary albumin-to-creatinine ratio
GTEx eQTL Artery_Aorta, Artery_Tibial, Cells_Cultured_fibroblasts, Esophagus_Muscularis, Heart_Left_Ventricle, Muscle_Skeletal, Testis, Whole_Blood