rs10818718 chr9:122562459 A>G
- Sequence
taggccctggtggcaggggctctc[A/G]agtgggatcttctgatctgtgggt
- ASB in cell types
- MOLT-4 (Adult T acute lymphoblastic leukemia) CTV-1 (Adult T acute lymphoblastic leukemia)
View in PheLiGe Color scale
-log10 FDR of Ref (A) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| MOLT-4 (Adult T acute lymphoblastic leukemia) | -0.12 | 1.58 | 1.00 | |||
| CTV-1 (Adult T acute lymphoblastic leukemia) | 1.13 | 0.02 | 1.00 |
Items per page:
1 – 2 of 2