rs10818782 chr9:98325004 G>A
- Sequence
cattattctagtttatagggttac[G/A]caactttcgggcttgaagagactc
- ASB in cell types
- U937 (adult acute monocytic leukemia)
- ASB for transcription factors
- CEBPA_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| CEBPA_HUMAN | 2.61 | -4.69 | 1.50 | -3.10 | Concordant |
Items per page:
1 – 1 of 1
Motif analysis
Genetic associations
GRASP hdl cholesterol, hip bone mineral density (bmd), parkinsons disease, resistance to kuru in aged women despite likely exposure, spine bone mineral density (bmd)