rs10821368 chr9:94563749 C>T
- Sequence
taaacaaacaaagaaaaaggaagt[C/T]acccatcccacatgcagtgccacc
- ASB in cell types
- GM12891 (male B- cells lymphoblastoid cell line) GM19099 (female B-cells Lymphoblastoid Cell Lines)
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| GM12891 (male B- cells lymphoblastoid cell line) | -1.27 | 1.57 | 1.00 | |||
| GM19099 (female B-cells Lymphoblastoid Cell Lines) | 1.99 | -1.41 | 1.00 |
Items per page:
1 – 2 of 2