rs10821808 chr10:60630888 G>A
- Sequence
agggaccagaaaggaggctacaac[G/A]tcaccaatatgagagatgatggta
- ASB for transcription factors
- CREB1_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| CREB1_HUMAN | 2.06 | n/a | 1.00 | -4.35 | Concordant |
Items per page:
1 – 1 of 1
Motif analysis
Genetic associations
GRASP 2 hour glucose, arthritis including non-rheumatoid, college completion, diastolic blood pressure (dbp), obesity with early age of onset (age >2), resistance to kuru in aged women despite likely exposure, stabilized warfarin dose, systolic blood pressure (sbp), years of education