rs10822187 chr10:63598703 G>A
- Sequence
gaggctgaggcaggagaatggcgc[G/A]aacccgggaggtggagtttgcagt
- ASB in cell types
- K562 (myelogenous leukemia)
- ASB for transcription factors
- CEBPB_HUMAN CEBPG_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| CEBPB_HUMAN | -2.26 | 4.06 | 2.00 | 4.75 | Concordant | |||
| CEBPG_HUMAN | -3.35 | 3.51 | 1.00 | 3.75 | Concordant |
Items per page:
1 – 2 of 2
Motif analysis
Genetic associations
GTEx eQTL Adipose_Visceral_Omentum, Artery_Tibial, Brain_Caudate_basal_ganglia, Brain_Cortex, Brain_Hypothalamus, Cells_Cultured_fibroblasts, Heart_Atrial_Appendage, Lung, Nerve_Tibial, Skin_Sun_Exposed_Lower_leg, Testis, Thyroid