rs10822919 chr10:66810633 A>T
- Sequence
aacacttcagctagaaactgagta[A/T]aatattttgttacttaaaatcttc
- ASB in cell types
- ARP-1(Plasma cell myeloma)
- ASB for transcription factors
- IKZF1_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (A) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| IKZF1_HUMAN | n/a | 4.23 | 2.00 | n/a | n/a |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GRASP advanced age-related macular degeneration (geographic atrophy), college completion, hdl cholesterol, urinary albumin-to-creatinine ratio, years of education