rs10823613 chr10:70759044 G>C
- Sequence
agaggaccagttggctgcaaattc[G/C]ttaacctctctgagcttagtgacc
- ASB in cell types
- GM19193 (female B-cells Lymphoblastoid Cell Lines) GM19240 (B cells Lymphoblastoid Cell Lines) LNCaP (prostate carcinoma) gastroesophageal sphincter
- ASB for transcription factors
- CTCF_HUMAN STAG1_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| CTCF_HUMAN | 1.58 | 0.16 | 1.26 | n/a | No Hit | |||
| STAG1_HUMAN | 0.87 | -0.88 | 1.76 | n/a | n/a |
Items per page:
1 – 2 of 2