rs10824083 chr10:74151584 C>G
- Sequence
agcagcccttcgccagtcgtggcc[C/G]gcagggggaccgagctggctgacc
- ASB in cell types
- pancreas tibial nerve HeLa (cervical adenocarcinoma) GM19238 (female B-cells lymphoblastoid cell lines)
- ASB for transcription factors
- CTCF_HUMAN SNAI2_HUMAN INT11_HUMAN SMC3_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| CTCF_HUMAN | -0.28 | 2.63 | 1.58 | 1.26 | Weak Concordant | |||
| SNAI2_HUMAN | 3.34 | n/a | 1.50 | 2.70 | Discordant | |||
| INT11_HUMAN | n/a | 2.90 | 3.00 | n/a | n/a | |||
| SMC3_HUMAN | -0.78 | 1.70 | 1.33 | n/a | n/a | |||
| CHD8_HUMAN | 0.99 | 2.15 | 1.00 | n/a | n/a |
Items per page:
1 – 5 of 6
Motif analysis
Genetic associations
GRASP aortic valve calcium, body mass index (bmi), mitral annular calcium, systolic blood pressure (sbp)
GTEx eQTL Adipose_Subcutaneous, Adipose_Visceral_Omentum, Artery_Aorta, Artery_Tibial, Brain_Frontal_Cortex_BA9, Cells_Cultured_fibroblasts, Esophagus_Mucosa, Esophagus_Muscularis, Heart_Atrial_Appendage, Heart_Left_Ventricle, Liver, Lung, Muscle_Skeletal, Nerve_Tibial, Skin_Not_Sun_Exposed_Suprapubic, Skin_Sun_Exposed_Lower_leg, Testis, Thyroid