rs10824274 chr10:75108709 C>T
- Sequence
gctctctgtctaccttatctcatg[C/T]cccaaatactatttcctgggcctc
- ASB in cell types
- K562 (myelogenous leukemia) foreskin keratinocyte
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| K562 (myelogenous leukemia) | 0.77 | 0.90 | 1.06 | |||
| foreskin keratinocyte | 3.01 | -5.41 | 2.25 |
Items per page:
1 – 2 of 2
Motif analysis
No data available
Genetic associations
GRASP hdl cholesterol change with statins, height, hip bone mineral density (bmd), hypertension (early onset hypertension), iga nephropathy, primary rhegmatogenous retinal detachment, systolic blood pressure (sbp), triglycerides
GTEx eQTL Adipose_Subcutaneous, Adipose_Visceral_Omentum, Artery_Aorta, Artery_Tibial, Cells_Cultured_fibroblasts, Esophagus_Mucosa, Heart_Atrial_Appendage, Heart_Left_Ventricle, Lung, Minor_Salivary_Gland, Muscle_Skeletal, Nerve_Tibial, Pancreas, Pituitary, Skin_Not_Sun_Exposed_Suprapubic, Skin_Sun_Exposed_Lower_leg, Testis, Thyroid, Whole_Blood