rs10825708 chr10:55989241 G>A
- Sequence
tgcgcatttgtggactttgaattt[G/A]cttgaattcacatcaatcatagtt
- ASB in cell types
- LNCaP (prostate carcinoma) GM02610 (Lymphoblastoid Cell Lines)
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| LNCaP (prostate carcinoma) | 0.41 | 2.74 | 1.00 | |||
| GM02610 (Lymphoblastoid Cell Lines) | 1.74 | -1.44 | 1.00 |
Items per page:
1 – 2 of 2