rs10826861 chr10:30752051 A>G
- Sequence
atagagacaggccaccagcagagg[A/G]ggccgcaggctcggacagagagct
- ASB in cell types
- GM12878 (female B-cells lymphoblastoid cell line) GM02630 (Fanconi anemi) GM19238 (female B-cells lymphoblastoid cell lines) HCT-116 (colon carcinoma)
- ASB for transcription factors
- CTCF_HUMAN STAG1_HUMAN RAD21_HUMAN SMC1A_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (A) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| CTCF_HUMAN | 0.55 | 2.92 | 1.69 | 4.42 | Concordant | |||
| STAG1_HUMAN | 4.11 | 3.96 | 2.00 | n/a | n/a | |||
| RAD21_HUMAN | 0.28 | 2.57 | 1.88 | n/a | n/a | |||
| SMC1A_HUMAN | -2.44 | 2.37 | 1.00 | n/a | n/a | |||
| SPI1_HUMAN | -3.61 | 3.29 | 1.00 | n/a | No Hit |
Items per page:
1 – 5 of 11
Motif analysis
Genetic associations
GRASP advanced age-related macular degeneration (geographic atrophy), aortic valve calcium, total cholesterol change with statins, waist hip ratio